1. What is the purpose of restriction enzymes?
a) To cut through restriction sites
b) To create equal fragment lengths
c) To maintain DNA shape
d) To cut the double stranded DNA to isolate the target sequence

4. Gel electrophoresis
a) Separates DNA based on their fragment lengths
b) Uses electric current to sort the fragments
c) Organizes fragment bands according to their size
d) All of the above

7. What is the difference between a probe and the target sequence?
a) A probe is the complementary strand of the target sequence.
b) They are identical
c) A probe is the inverse of a target sequence
d) Probes are made of RNA

9. Based on the diagram, we can conclude that:
a) Jill has cheated on Jack. Jack is not the Payle’s father
b) Jack and Jill are Payle’s parents
c) Payle is adopted
d) Jill is Payle’s step-mom

2. Which of the following statements regarding restriction enzymes and fragment lengths is NOT true:
a) Fragment lengths are determined by the location of restriction sites on DNA
b) Every restriction enzyme has its own recognition sequence
c)

5. Which of the following statements regarding blots is true?
a) Are created by gel electrophoresis
b) Help further separate DNA fragments
c) Allow the DNA fragments to be trapped in their position
d) None of the above

8. Restriction Fragment Length Polymorphism has been _________________.
a) Used to detect genetic disorders
b) Replaced by PCRs
c) Used in paternity cases
d) All of the above

10. If an enzyme can detect the sequence GAATTC, how many fragments will result in the following DNA strand with sequence: (hint: locate the restriction sequences)
GTAAGAATTCTTTAGAATTCCGCCATTATCGAATTCAGGATCTTAC
a) 2
b) 3
c) 4
d) 7

3. What determines the amount of restriction fragments?
a) The number of restriction sites
b) The cutting is random
c) The length of the target sequence
d) a) and c)

6. DNA probes are important because they:
a) Are pre-synthesized sequences
b) Are radioactive
c) Are the same size as the target sequence
d) All of the above
e) Two of the above